Seudónimo Seudónimo

01-11-2015
Computers and Technology

contestada

Lures, reels, rods, hooks, baits and nets are common equipment used in what food gathering method?

Respuesta :

01-11-2015

in gathering fish...

Answer Link

KeaneNR KeaneNR

01-11-2015

They are all used for fishing.

Answer Link

Otras preguntas

Paula begins to notice there are patterns to where people sit on the bus, and that these patterns differ depending on whether the rider is male or female. based

Let f(x) = x+7 and g(x) = x-4 Find f(x) times g(x)

Isabelle has been forgetting a lot of things lately, and her friends and family have been angry with her. Today, she feels as if she's going to do something wr

Bartók's Concerto for Orchestra is written for A. full orchestra and singer. B. string quartet and orchestra. C. full orchestra. D. full orchestra

crystal lattice definition

What value is added to both sides of the equation x2 − 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2

what was considered an act of war in 1914?

which nutrition provides the highest number of calories per grama)fatb)proteinc) carbohydrated)suger

Which geographic characteristics makes Washington such an important state for international trade? A. It's distance from Canada and Mexico B. It's location on t

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat