zaynabintali
zaynabintali zaynabintali
  • 01-04-2017
  • Mathematics
contestada

If 12 counters are three fourths of a set how many counters are in full set?

Respuesta :

KitKat69
KitKat69 KitKat69
  • 01-04-2017
Divide 12 by 3 to find 1/4: 12/3=4. Then multiply 1/4 by 4 to find 4/4: 4•4=16. So there would be 16 in a full set :)
Answer Link

Otras preguntas

what's the percentage of 1/8 ?
what rule does static electricity follow
who was the founder of Pennsylvania?
Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Which term refers to the military dictators who took power in Latin America after the Spanish were driven out? A. conquistadores B. creoles C. caudillos D.
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front