czh8nbw52d czh8nbw52d
  • 04-04-2022
  • Chemistry
contestada

SO2 + H2O +_ H2SO3
I need to know how to balance simple direct combination reactions

Respuesta :

maryyy128 maryyy128
  • 04-04-2022
Hi so first of all count the number of atoms on both sides.
S = 1
O = 2

H = 2, O = 1

H = 2, S = 1, O = 3

Have a go at multiplying and seeing if you can get each atom to have the same number.
Answer Link

Otras preguntas

Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
How to change 3 7/8 into an improper fraction
what is 0.00001267 is scientific notation
Compliant is to stubborn as excited is to
The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body.
How many years does an apple tree live useful?