thshyqueen thshyqueen
  • 03-10-2021
  • Mathematics
contestada

The product of twice a number and three is the same as the difference of five times the number and 7/9. Find the number.

Respuesta :

anasweeney43 anasweeney43
  • 03-10-2021

Answer:

n = - 7/9

Step-by-step explanation:

2n * 3 = 5n - 7/9

6n = 5n - 7/9

6n - 5n = - 7/9

n = - 7/9

Answer Link

Otras preguntas

Please help me with this two step math problem! THANK YOU !!!!!!!!
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Companies raise funds to expand their business by
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
Fossils are most commonly found in which type of rock?
testosterone directly affects the
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
i need help with #3