chelseytownsend2004 chelseytownsend2004

03-10-2021
Mathematics

contestada

The area of a triangle is ……

The area of a triangle is class=

Respuesta :

Aanya33 Aanya33

03-10-2021

Answer:

17.5 in²

Step-by-step explanation:

A=b×h/2

A=5×6/2

A=17.5

Answer Link

Otras preguntas

A mutation that occurs in the gametes of an organism will most likely be transferred where

how many moles of NaCl are equivalent to 15.6g NaCl

Help plsssssssssssss

The degree measure of angle a is 135°. which expression below is equivalent to the radian measure of angle a?

Explain how an enlargement or a reduction in the dimensions of a building would cause a change in the scale factor.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Who is largely responsible for the spread of hellenistic culture in the 4th century bc?

30.0 ml of an hf solution were titrated with 22.15 ml of a 0.122 m koh solution to reach the equivalence point. what is the molarity of the hf solution?

which statement about nuclear fusion is correctA) Two hydrogen electrons become protons during fusion B) Helium nuclei xan fuse to form electrons such as nitrog

Joseph and cleoma, who made the first cajun recording, were husband and wife