amanr88102
amanr88102 amanr88102
  • 03-01-2021
  • English
contestada

change the following sentence into passive voice - we will borrow money from a bank​

Respuesta :

braganzaesther braganzaesther
  • 03-01-2021

Answer: The money in the bank was borrowed by us.

Answer Link

Otras preguntas

why do stomach cells need more lysosomes than heart cells
Graph ​24x+25=−6y+7​ . please help :)
Find the distance between the pairs of points (-4,-2) and (1,5). Round to the nearest tenth.
f(x) = 2x - 10 at x = -4
Solve H= -b divided by 2a for b
How do I find the answer to this problume−9−13+2+13minus, 9, minus, 13, plus, 2, plus, 13.
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
32 markup 12.5% retail price
True False 1. A convertible term policy can be converted into a cash-value policy 2. All insurance policies cost the same 3. All reputable health insurance plan
Which statement best explains how El Camino Real helped to blend cultures in the region? A. El Camino Real made it possible for people to visit their friends an